Smp 099770

From Schistosome Wiki @ IBERS
Jump to navigation Jump to search

GeneDB ID: smp_099770

Protein Name: SmTSP7

Full Length clone: Yes

Full Length clone sequence


Primers used

smp_099770 FL F: AAACAACAATGAAGCTCAAG (partially 5' UTR)

smp_099770 FL R: GAATGTAGTTAAGTTGAATTCTCA (completely in 3' UTR)


pCR-Blunt (Zeroblunt - Invitrogen) Kanamycin resistance

Glycerol Stock

Box 1 R1C3

Microarray Lifecycle Profile

Smp 099770.jpg

50mer - Contig6455

Data obtained from Fitzpatrick et al., 2009

Protein Expression

Expression Vector - modified pET30a

Sequence modified/truncated - Yes (only extracellular loop 2 expressed)

Purification tag - 6XHis (c-terminal only)

Expressed protein sequence


Expressed protein MW/PI - 10.4kDa / 5.91
